Alphabet
An alphabet is a m-tuple of unique elements.
Mathematical Definition
Let \(X\) is Carrier set
The alphabet \(A\) is a m-tuple with a uniqueness constraint, can be defined:
Where:
- \(m := |A|\) is called power of the alphabet, \(m \in N\)
- \(a_i\) is called the \(i\)-th element (or coordinate) of the alphabet.
Alphabet of Sequence
Let \(X\) is Carrier set
Let \(S\) is Sequence described as function \(S : \{1,...,n\} \longrightarrow X\)
Where:
- \(m \leq n\) - power of the alphabet is not greater than length of the sequence
Examples
Binary Sequence
A binary sequence 0110100110
represented as
\(X = \{0,1\}\)
\(A = <0,1>\)
Musical Chorus Sequence
A musical chorus for Jingle bell rock
D Dmaj7 D6
Jingle-bell, Jingle-bell, Jingle-bell Rock.
D D#dim
Jingle-bell swing and
Em A7 Em A7 Em A7
Jingle-bell ring. Snowin' and blowin' up bushels of fun.
Em A9 A7
Now the jingle-hop has begun.
\(X = \{A7, A9, D, D6, Dmaj7, D\#dim, Em\}\)
\(A = <D,Dmaj7,D6,D,D\#dim,Em,A7,A9>\)
DNA Sequence
A DNA sequence ATGCTAGCATGCTAGCATGCTAGC
\(X = \{A,C,T,G\}\)
\(A = <A,T,G,C>\)
English Text Sequence as char sequence
An English text sentence the quick brown fox jumps over the lazy dog
\(X = \{\ ,a,b,c,d,e,f,g,h,i,j,k,l,m,n,o,p,q,r,s,t,u,v,w,x,y,z\}\)
\(A = <t,h,e,\ ,q,u,i,c,k,b,r,o,w,n,f,x,j,m,p,s,v,l,a,z,y,d,g>\)
English Text Sequence as word sequence
An English text sentence the quick brown fox jumps over the lazy dog
\(X = \{\ ,quick, fox, brown, the, over, dog, fox, lazy\}\)
\(A = <the,\ ,quick,brown,fox,jumps,over,lazy,dog>\)